Part: BBa_K292008

Home

Categories for BBa_K292008

Back

DNA sequence for BBa_K292008

Back
GCATGCTTTGCATACTTCTGCCTGCTGGGGAGCCTGGGGACTTTCCACACCCTAACTGACACACATTCCACAGCTGGTTC TTTCCGCCTCAGAAGGTACCT