Part: BBa_K337101

Home

Categories for BBa_K337101

Back

DNA sequence for BBa_K337101

Back
GCTACGGTCTCTAACCTTACCAGCACGGTCCAGGTCTTCACGGACTCAGACTATCAGCTCCCGTACGTGCTCGGGTCGGC TCACGAGGGCTGCCTCCCGCCGTTCCCAGCGGACGTTTTCATGATTCCTCAGTACGGGTATCTGACGCTTAATGATGGAA GCCAGGCCGTGGGTCGTTCGTCCTTTTACTGCCTGGAATATTTCCCGTCGCAAATGCTAAGAACGGGTAACAACTTCCAG TTCAGCTACGAGTTTGAGAACGTACCTTTCCATAGCAGCTGAGACCGTAGC