Part: BBa_K228223

Home

Categories for BBa_K228223

Back

DNA sequence for BBa_K228223

Back
TGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCTACTAGAGAAAGAGGAGAAATACTAGATGAAAAACATAAATGC CGACGACACATACAGAATAATTAATAAAATTAAAGCTTGTAGAAGCAATAATGATATTAATCAATGCTTATCTGATATGA CTAAAATGGTACATTGTGAATATTATTTACTCGCGATCATTTATCCTCATTCTATGGTTAAATCTGATATTTCAATCCTA GATAATTACCCTAAAAAATGGAGGCAATATTATGATGACGCTAATTTAATAAAATATGATCCTATAGTAGATTATTCTAA CTCCAATCATTCACCAATTAATTGGAATATATTTGAAAACAATGCTGTAAATAAAAAATCTCCAAATGTAATTAAAGAAG CGAAAACATCAGGTCTTATCACTGGGTTTAGTTTCCCTATTCATACGGCTAACAATGGCTTCGGAATGCTTAGTTTTGCA CATTCAGAAAAAGACAACTATATAGATAGTTTATTTTTACATGCGTGTATGAACATACCATTAATTGTTCCTTCTCTAGT TGATAATTATCGAAAAATAAATATAGCAAATAATAAATCAAACAACGATTTAACCAAAAGAGAAAAAGAATGTTTAGCGT GGGCATGCGAAGGAAAAAGCTCTTGGGATATTTCAAAAATATTAGGTTGCAGTGAGCGTACTGTCACTTTCCATTTAACC AATGCGCAAATGAAACTCAATACAACAAACCGCTGCCAAAGTATTTCTAAAGCAATTTTAACAGGAGCAATTGATTGCCC ATACTTTAAAAATTAATAACACTGATAGTGCTAGTGTAGATCACTACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCA GTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGG GTGGGCCTTTCTGCGTTTATATACTAGAGACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAA TAAATACTAGAGTTTCTCCTCTTTAATTACTAGATGACCATGATTACCGTGCACTAGAATACCATTAACATTGCTAAGAA CGACTTCTCTGACATCGAACTGGCTGCTATCCCGTTCAACACTCTGGCTGACCATTACGGTGAGCGTTTAGCTCGCGAAC AGTTGGCCCTTGAGCATGAGTCTTACGAGATGGGTGAAGCACGCTTCCGCAAGATGTTTGAGCGTCAACTTAAAGCTGGT GAGGTTGCGGATAACGCTGCCGCCAAGCCTCTCATCACTACCCTACTCCCTAAGATGATTGCACGCATCAACGACTGGTT TGAGGAAGTGAAAGCTAAGCGCGGCAAGCGCCCGACAGCCTTCCAGTTCCTGTAGGAAATCAAGCCGGAAGCCGTAGCGT ACATCACCATTAAGACCACTCTGGCTTGCCTAACCAGTGCTGACAATACAACCGTTCAGGCTGTAGCAAGCGCAATCGGT CGGGCCATTGAGGACGAGGCTCGCTTCGGTCGTATCCGTGACCTTGAAGCTAAGCACTTCAAGAAAAACGTTGAGGAACA ACTCAACAAGCGCGTAGGGCACGTCTACAAGAAAGCATTTATGCAAGTTGTCGAGGCTGACATGCTCTCTAAGGGTCTAC TCGGTGGCGAGGCGTGGTCTTCGTGGCATAAGGAAGACTCTATTCATGTAGGAGTACGCTGCATCGAGATGCTCATTGAG TCAACCGGAATGGTTAGCTTACACCGCCAAAATGCTGGCGTAGTAGGTCAAGACTCTGAGACTATCGAACTCGCACCTGA ATACGCTGAGGCTATCGCAACCCGTGCAGGTGCGCTGGCTGGCATCTCTCCGATGTTCCAACCTTGCGTAGTTCCTCCTA AGCCGTGGACTGGCATTACTGGTGGTGGCTATTGGGCTAACGGTCGTCGTCCTCTGGCGCTGGTGCGTACTCACAGTAAG AAAGCACTGATGCGCTACGAAGACGTTTACATGCCTGAGGTGTACAAAGCGATTAACATTGCGCAAAACACCGCATGGAA AATCAACAAGAAAGTCCTAGCGGTCGCCAACGTAATCACCAAGTGGAAGCATTGTCCGGTCGAGGACATCCCTGCGATTG AGCGTGAAGAACTCCCGATGAAACCGGAAGACATCGACATGAATCCTGAGGCTCTCACCGCGTGGAAACGTGCTGCCGCT GCTGTGTACCGCAAGGACAAGGCTCGCAAGTCTCGCCGTATCAGCCTTGAGTTCATGCTTGAGCAAGCCAATAAGTTTGC TAACCATAAGGCCATCTGGTTCCCTTACAACATGGACTGGCGCGGTCGTGTTTACGCTGTGTCAATGTTCAACCCGCAAG GTAACGATATGACCAAAGGACTGCTTACGCTGGCGAAAGGTAAACCAATCGGTAAGGAAGGTTACTACTGGCTGAAAATC CACGGTGCAAACTGTGCGGGTGTCGATAAGGTTCCGTTCCCTGAGCGCATCAAGTTCATTGAGGAAAACCACGAGAACAT CATGGCTTGCGCTAAGTCTCCACTGGAGAACACTTGGTGGGCTGAGCAAGATTCTCCGTTCTGCTTCCTTGCGTTCTGCT TTGAGTACGCTGGGGTACAGCACCACGGCCTGAGCTATAACTGCTCCCTTCCGCTGGCGTTTGACGGGTCTTGCTCTGGC ATCCAGCACTTCTCCGCGATGCTCCGAGATGAGGTAGGTGGTCGCGCGGTTAACTTGCTTCCTAGTGAAACCGTTCAGGA CATCTACGGGATTGTTGCTAAGAAAGTCAACGAGATTCTACAAGCAGACGCAATCAATGGGACCGATAACGAAGTAGTTA CCGTGACCGATGAGAACACTGGTGAAATCTCTGAGAAAGTCAAGCTGGGCACTAAGGCACTGGCTGGTCAATGGCTGGCT TACGGTGTTACTCGCAGTGTGACTAAGCGTTCAGTCATGACGCTGGCTTACGGGTCCAAAGAGTTCGGCTTCCGTCAACA AGTGCTGGAAGATACCATTCAGCCAGCTATTGATTCCGGCAAGGGTCTGATGTTCACTCAGCCGAATCAGGCTGCTGGAT ACATGGCTAAGCTGATTTGGGAATCTGTGAGCGTGACGGTGGTAGCTGCGGTTGAAGCAATGAACTGGCTTAAGTCTGCT GCTAAGCTGCTGGCTGCTGAGGTCAAAGATAAGAAGACTGGAGAGATTCTTCGCAAGCGTTGCGCTGTGCATTGGGTAAC TCCTGATGGTTTCCCTGTGTGGCAGGAATACAAGAAGCCTATTCAGACGCGCTTGAACCTGATGTTCCTCGGTCAGTTCC GCTTACAGCCTACCATTAACACCAACAAAGATAGCGAGATTGATGCACACAAACAGGAGTCTGGTATCGCTCCTAACTTT GTACACAGCCAAGACGGTAGCCACCTTCGTAAGACTGTAGTGTGGGCACACGAGAAGTACGGAATCGAATCTTTTGCACT GATTCACGACTCCTTCGGTACCATTCCGGCTGACGCTGCGAACCTGTTCAAAGCAGTGCGCGAAACTATGGTTGACACAT ATGAGTCTTGTGATGTACTGGCTGATTTCTACGACCAGTTCGCTGACCAGTTGCACGAGTCTCAATTGGACAAAATGCCA GCACTTCCGGCTAAAGGTAACTTGAACCTCCGTGACATCTTAGAGTCGGACTTCGCGTTCGCATAATACTAGAGCCAGGC ATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAG AGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATA